Kurz erklärt: Der genetische Fingerabdruck

Was ist eigentlich der genetische Fingerabdruck? Er ist das DNA-Profil, das sich aus der Analyse von unterschiedlichen Abschnitten der DNA ergibt. Die Wahrscheinlichkeit, dass ein anderer Mensch den gleichen genetischen Fingerabdruck hat, wird auf 1:30 Milliarden geschätzt. Je mehr Marker man testet, je größer ist dieses Verhältnis. Früher umfasste die deutsche DNA-Analysedatei der Polizeibehörden 8 DNA-Marker (DNA-Abschnitte), heute sind es mehr, zumindest bei Proben, die neu untersucht werden. Die alten Datensätze beinhalten 8 oder weniger DNA-Marker. Bei den meisten Vaterschaftsgutachten sind 22 Marker Standard. bj-diagnostik testet bis zu 23 Marker.

DNA und genetischer Fingerabdruck

Die DNA besteht aus Nucleinsäuren bzw. Nucleotiden, die sich aus einem Zuckermolekül, einem Phospatrest und einer organischen Base - Adenin, Cytosin, Guanin oder Thymin (kurz A, C, G und T) - zusammen setzen. Die Ermittlung des genetischen Fingerabdruckes bedient sich sogenannter Minisatelliten (Short Tandem Repeats, STR) auf der DNA. Diese Abschnitte kodieren keine genetischen Eigenschaften im Sinne von Basentriplets; man erkennt lediglich das Geschlecht einer Person, das mit XX (weiblich) und XY (männlich) gekennzeichnet wird. Es handelt sich um DNA-Abschnitte, in denen ein 4 bis 5 Nukleotide langes Basenmuster mehrmals wiederholt wird (z.B. GATTA). Jeder Mensch besitzt von jedem DNA-Abschnitt (auch Genort oder Loci genannt) zwei Versionen (Allele genannt), von denen er jeweils eines von der Mutter, eines vom Vater geerbt hat. In einem solchen DNA-Profil wird dann bestimmt wie oft ein solches Repeatmuster auf einem bestimmten Marker (Genort, DNA-Abschnitt) wiederholt wird. Diese Wiederholungen treten circa 5 - 50 mal, je nach Genort, auf.

Beispiel für einen genetischen Fingerabdruck

Untersucht man nun z.B. bei einer Person den Genort "D7S820", könnte man folgendes finden:

Allel 1:

GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA

Allel 2:

GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA

Bei Allel 1 ist also die Abfolge "GATA" 10 mal wiederholt, bei Allel 2 dagegen 11 mal. Dies wird dann beim genetischen Fingerabdruck wie folgt notiert: D7S820 10 11. Ein genetischer Fingerabdruck wird als Folge aus Buchstaben und Zahlen dargestellt, das heisst dem Namen des Locus (zum Beispiel TPOX, THO1, D16S53) und der Anzahl der Wiederholungen beim  jeweiligen Allel (zum Beispiel 1011, 66, etc.): D7S8201011AmelogeninXYTPOX67.....

Welches Allel dabei von der Mutter und welches vom genetische Vater stammt, kann nur durch Vergleich der DNA-Profile des Vaters und des Kindes erfolgen, eben durch einen DNA Vaterschaftstest. Abstammungstest, Vaterschaftsnachweis, Abstammungsnachweis oder Abstammungsgutachten sind synonym verwendete Begriffe. Unter dem Begriff Abstammungsgutachten wird oft mit einem "besonders richtigen" Vaterschaftstest gleichgesetzt, es gibt aber keinen Unterschied zum Vaterschaftstest, nur, dass man für ein Abstammungsgutachten deutlich mehr bezahlen soll. In der Regel findet man auf einem Genort immer zwei Allele, zumindest bei Proben humanen Ursprungs, entweder zwei verschiedene Allele (als heterozygot bezeichnet) oder zwei gleiche Allele (als homozygot bezeichnet).

Testset gratis
bestellen >>

Sie zahlen nur dann, wenn Sie den unterschriebenen Auftrag einsenden.

 

Unsere Hotline
Vaterschaftstest
0551 - 500 72 999

Das Team der bj-diagnostik berät Sie gerne.

 

Vaterschaftstest: Akkreditiertes Qualitätslabor für Abstammungsanalysen - bj-diagnostik GmbH