Erklärung Ergebnis Vaterschaftstest

Wie sieht ein Vaterschaftsgutachten aus?

Der Ergebnisbericht eines Vaterschaftstests besteht aus folgenden wesentlichen Elementen:

  • Auflistung der Personen, die an der Abstammungsuntersuchung teilgenommen haben
  • kurze Erklärung des Analyseverfahrens
  • tabellarische Gegenüberstellung der genetischen Fingerabdrücke der untersuchten Personen (zum Beispiel Vater, Kind und Mutter), um zu zeigen, welche Erbmerkmale sie gemeinsam haben
  • Zusammenfassung und Ergebnis des Gutachtens

    • Bestätigung mit mindestens 99,9%, bis zu 99,99999999%
    • Ausschluss der Vaterschaft zu 100%

Wie wird der genetische Fingerabdruck erstellt?

bj-diagnostik untersucht 23 sogenannte genetische Marker mit dem Amelogenin-Locus zur Differenzierung des Geschlechtes im Rahmen der Qualitätskontrolle (dabei bedeutet XX weiblich und XY männlich). Jeder genetische Marker zeigt alternative DNA-Sequenzen. Diese Varianten bezeichnet man als Allele, von denen jeder Mensch zwei Versionen besitzt, je eines von Vater und Mutter vererbt.

Beim genetischen Fingerabdruck, der für den Vaterschaftstest verwendet wird, verwendet man keine Marker, die genetische Eigenschaften kodieren, sondern sogenannte Short Tandem Repeats, die ein 4 oder 5 Nukleotide langes Basenmuster mehrfach wiederholen (zum Beispiel GATA). Die Anzahl der Wiederholungen wird dann im genetischen Fingerabdruck als Zahl abgebildet (zum Beispiel GATAGATAGATAGATAGATAGATA sind 6 Wiederholungen). So kann der Genort mit dem Namen D7S820 auf dem Chromosom 7 das Muster GATA 6 mal, 7 mal, 8 mal und so weiter wiederholen. Somit könnte das Allel auf einem Chromosom 6 sein (zum Beispiel von der Mutter vererbt) und auf dem anderen Chromosom 8 (zum Beispiel vom Vater vererbt).

Ablauf der DNA-Analyse im Labor

  1. DNA-Extraktion
  2. DNA-Amplifikation der jeweiligen DNA-Marker (PCR-Verfahren, Polymerase Chain Reaction)
  3. Fragmentanalyse der amplifizierten DNA-Marker mittels DNA-Sequenzer
  4. Mathematische Berechnung der Vaterschaftswahrscheinlichkeit durch Vergleich der genetischen Fingerabdrücke der Testpersonen z.B. von Vater und Kind 
  5. Erstellung des Gutachtens

Bestätigung der Vaterschaft

Durch den Vergleich der genetischen Fingerabdrücke von Vater und Kind oder Vater, Kind und Mutter wird die Wahrscheinlichkeit berechnet, mit der der untersuchte Mann der biologische Vater des Kindes ist. Alternativ wird die Vaterschaft ausgeschlossen. Nach dem Erbgang der untersuchten DNA-Systeme müssen Vater und Kind in jedem untersuchten System (Marker) ein gemeinsames Erbmerkmal (Allel) aufweisen.

Die nachfolgende Grafik zeigt übereinstimmende Allele bei den genetischen Fingerabdrücken von Vater und Kind:

Erklärung Ergebnis Vaterschaftstest, Bestätigung der Vaterschaft

Für jeden untersuchten Marker wird der Likelihood Ratio berechnet. Der Likelihood Ratio ist ein Wahrscheinlichkeitsquotient. Dieser Quotient beschreibt das Verhältnis der Wahrscheinlichkeiten von zwei Hypothesen:

H0: Der untersuchte Mann ist der Vater des Kindes

gegen

H1: Ein anderer (zum getesteten Mann nicht verwandter) Mann ist der Vater des Kindes

Ist ein LR größer als 1 spricht dies für die Hypothese, die im Zähler steht (H0), ist der LR-Wert kleiner als 1 spricht dies für die Hypothese, die im Nenner steht (H1). Der LR-Wert wird nun für jeden Marker berechnet. Die Verteilung der Allele in einer Bevölkerungsgruppe ist unterschiedlich. Teilen Vater und Kind ein seltenes Allel ergibt sich ein höherer Likelihood Ratio als wenn beide ein häufig vorkommendes Allel gemeinsam haben.

Um den LR-Wert als Wahrscheinlichkeit auszudrücken, muss eine sogenannte "a priori" Wahrscheinlichkeit eingeführt werden. Diese ist in der Regel 50% für die Wahrscheinlichkeit, dass der getestete Mann der Vater des Kindes ist (H0) gegen die Wahrscheinlichkeit, dass ein anderer, zum Getesteten nicht verwandter Mann der Vater des Kindes ist (H1). Ein LR-Wert von 1000 korrespondiert zu einem Wahrscheinlichkeits-Wert von 99,9%. Eine Null mehr am LR-Wert führt demnach zu einer Neun mehr hinter dem Komma des W-Werts.

Wenn der getestete Mann in allen untersuchten DNA-Systemen übereinstimmende Erbmerkmale (Allele) mit dem Kind aufweist, kommt er als Vater des Kindes in Frage. Die genaue Wahrscheinlichkeit ergibt sich durch den über die getesteten Marker berechneten Gesamtwert. Der Gesamtwert ist das Produkt der Einzel-LR-Werte.

Das Ergebnis des Vaterschaftstests ergibt dann zum Beispiel eine Wahrscheinlichkeit von 99,99999% für die Bestätigung einer Vaterschaft oder 100% für den Ausschluss der Vaterschaft. Ab 99,9% gilt die Vaterschaft als praktisch erwiesen. bj-diagnostik kann Werte von 99,99999999% und darüber hinaus erreichen.

Vergleich der genetischen Fingerabdrücke bei Bestätigung der Vaterschaft

Die folgende Grafik zeigt die Gegenüberstellung zweier genetischer Fingerabdrücke von Vater und Kind bei einer Bestätigung der Vaterschaft:

Erklärung Ergebnis Vaterschaftstest, Bestätigung der Vaterschaft mit Berechnung der Wahrscheinlichkeit

Wenn ein Marker zwischen Vater und Kind nicht übereinstimmt, kann es sich um eine Mutation handeln. Solche Mutationen haben alle Menschen in ihrem Genom. Bei Abstammungstests untersucht man jedoch nur einen sehr kleinen Teil des Genoms, so dass Mutationen nur selten eine Rolle spielen. Stimmen 2 oder 3 Marker zwischen Vater und Kind nicht überein, müssen weitere verwandte Personen in den Vaterschaftstest einbezogen werden, insbesondere die Mutter.

Die Gendiagnostik-Kommission hat einen Mindestwert von 99,9% bestimmt, der für die Bestätigung einer Vaterschaft erforderlich ist.

Ausschluss der Vaterschaft

Für den Ausschluss der Vaterschaft müssen bei mindestens 4 Markern nicht übereinstimmende Erbmerkmale von Vater und Kind vorliegen. Dies ist ein von der Gendiagnostik-Kommission festgelegter Wert, der auf Erfahrungswerten beruht.

Wenn mindestens 4 Marker nicht übereinstimmen, ist der getestete Mann als genetischer Vater des Kindes auszuschließen.

Vergleich der genetischen Fingerabdrücke bei Ausschluss der Vaterschaft

Die folgende Grafik zeigt den Vergleich eines genetischen Fingerabdruckes von Vater, Kind und Mutter bei einem Ausschluss der Vaterschaft:

Erklärung Ergebnis Vaterschaftstest, Ausschluss der Vaterschaft

bj-diagnostik stellt ein Online-Tool zur Berechnung der Wahrscheinlichkeit der Vaterschaft zur Verfügung. An dieser Stelle sind weitergehende Informationen zur Wahrscheinlichkeitsberechnung, dem Likelihood Ratio und der Bedeutung von Allel-Frequenztabellen zusammengefasst.

Kaufen kann man den Vaterschaftstest unter Testset gratis bestellen.

Testset gratis
bestellen >>

Sie zahlen nur dann, wenn Sie den unterschriebenen Auftrag einsenden.

 

Unsere Hotline
Vaterschaftstest
0551 - 500 72 999

Das Team der bj-diagnostik berät Sie gerne.

 

Vaterschaftstest: Akkreditiertes Qualitätslabor für Abstammungsanalysen - bj-diagnostik GmbH